Contribution to the phylogeny of Microgastrinae (Hymenoptera: Braconidae) based on mitochondrial COI and nuclear 28S rDNA genes, with comments on the identity of Pholetesor circumscriptus (Nees, 1834)

Parisa Abdoli, Ali Asghar Talebi

Department of Entomology, Faculty of Agriculture, Tarbiat Modares University, Tehran, I.R. Iran.

https://orcid.org/0000-0001-6866-0337

https://orcid.org/0000-0001-5749-6391

Nickolas G. Kavallieratos

Laboratory of Agricultural Zoology and Entomology, Department of Crop Science, Agricultural University of Athens; 75 Iera Odos str., 11855 Athens, Attica, Greece.

https://orcid.org/0000-0001-5851-5013

Rasoul Khosravi

Department of Natural Resources and Environmental Engineering, College of Agriculture, Shiraz University, Shiraz, Iran.

https://orcid.org/0000-0002-7231-563X

Farzad Bidari

Hawkesbury Institute for the Environment, Western Sydney University, Penrith, NSW, Australia. 

https://orcid.org/0009-0000-6953-7218

ABSTRACT. Microgastrines are diverse group of endoparasitoid wasps attacking caterpillars (Lepidoptera). Despite their importance in biological control, there is still no consensus concerning the phylogeny relationships among taxa. Although previous phylogenetic analyses have advanced the overall understanding of phylogenetic relationships of Microgastrinae, the small numbers of sampled taxa have led to disagreement in taxonomic assignments. In the present study, we performed a molecular genetic survey using both mitochondrial and nuclear data, increasing the taxons' sampling, to clarify the generic relationships and improve the inferences of the taxonomic status within Microgastrinae. We reconstructed a phylogenomic tree of Microgastrinae with sequences that exist up till now, from fifty-five genera for COI and thirty genera for 28S rDNA, both new and from previous studies. Several species and genera have been sequenced for the first time. In this study, we identified some of the closest phylogenetic relatives of Microgastrinae genera by analyzing DNA sequences from the mitochondrial COI and 28S rDNA. Most clades of the current findings correspond to the latest morphological classification of Microgastrinae. New clades and several well-supported clades, conform to the most previously recorded clades and provide an increased understanding of the Microgastrinae evolution. Based on molecular examination, Pholetesor psedocircumscriptus Abdoli, 2019 is synonymized with Pholetesor circumscriptus (Nees, 1834).

Keywords: Molecular phylogeny, DNA sequences, Bayesian method, new synonym

Citation: Abdoli, P., Talebi, A.A., Kavallieratos, N.G., Khosravi, R. & Bidari, F. (2024) Contribution to the phylogeny of Microgastrinae (Hymenoptera: Braconidae) based on mitochondrial COI and nuclear 28S rDNA genes, with comments on the identity of Pholetesor circumscriptus (Nees, 1834). Journal of Insect Biodiversity and Systematics, 10 (4), 965–981.

INTRODUCTION 

Microgastrinae (Hymenoptera, Braconidae) is one the most species-rich subfamilies of Braconidae consisting of 2999 known species belonging to 81 genera across the world (Fernandez-Triana et al., 2020). Microgastrines play a crucial role as koinobiont endoparasitoids of Lepidopteran larva (Shaw & Huddleston, 1991). Despite their importance in biological control, the phylogenetic relationships within Microgastrinae still remain questionable and controversial while no comprehensive studies have investigated their phylogeny, genetic diversity, and spatial patterns. Existing molecular studies have provided inconclusive results, highlighting the monophyletic position of many microgastrine taxa, while their phylogenetic position varies depending on the utilized molecular marker and the number of sampled taxa (Belshaw et al., 1998; Pitz et al., 2007; Sharanowski et al., 2011; Shi et al., 2005; Whitfield et al., 2002, 2018; Jasso-Martinez et al., 2022).

Numerous hypotheses have been proposed regarding the phylogenetic relationships among taxa and their phylogenetic inconsistencies. Murphy et al. (2008) presented a clade comprising five subfamilies (i.e., Cardiochilinae, Khoikhoinae, Mendesellinae, Microgastrinae, and Miracinae) as a sister lineage in the family Braconidae. Whitfield et al. (2018) synthesized molecular data from various literatures to outline some generic relationships within the subfamily Microgastrinae. According their summary Microplitis, Snellenius; Cotesia, Glyptapanteles, Sathon, Venanides; Apanteles s.str., Alphomelon, Rhygoplitis; Prasmodon, Pseudapanteles; Dolichogenidea, Pholetesor (in part); Promicrogaster and Sendaphne are closely related and form a clade (Banks & Whitfield, 2006; Mardulyn & Whitfield, 1999; Whitfield et al., 2002, 2018). Previous studies have identified conflicts among molecular and morphological data within the genera of Microgastrinae, resolving only some terminal nodes (Mardulyn & Whitfield, 1999; Whitfield et al., 2002, 2018; Fernandez-Triana et al., 2020). Therefore, the investigation of the phylogenetic position of Microgastrinae genera and precisely reconstructing their phylogeny improves the overall knowledge of the phylogeny of this subfamily.

The incongruent phylogenetic relationships within Microgastrinae and the possibility of increasing the sampling of taxa have motivated researchers to conduct more studies to unravel the exact phylogenetic relationships among taxa. It has been noted that the inclusion of additional molecular markers, without a concurrent expansion of taxon sampling, may result in a diminished phylogenetic signal (Banks & Whitfield, 2006; Jantzen et al., 2019; Dong et al., 2022). On the other hand, some studies have suggested that effective taxon sampling plays a crucial role in resolving controversies in phylogenetic inference, highlighting the impact of adding specific taxa on inference performance. As more taxon sequencing data becomes available, the positioning of species within clades offers an avenue to enhance our understanding of these taxa, revealing new relationships. The availability of such new data can significantly influence hypotheses supported by phylogenetic inference, promoting researchers to formulate novel ideas about potential relationships among taxa (Rannala et al., 1998; Nabhan & Sarkar, 2012; Jantzen et al., 2019; Dong et al., 2022). The genera of Microgastrinae exhibit challenges for taxonomists due to convergent morphological characters, and complicating classification. Fernandez-Triana et al. (2020) categorized the 81 genera into three specified groups, i.e., Cotesia, Microplitis, and Apanteles, with distinct morphological diagnosis for each group. They also identified a group with unplaced genera that likely belonged elsewhere, designating it as the unplaced group. They emphasized that these groups do not represent a new phylogeny for the subfamily.

 The phylogeny of Microgastrinae is challenging due to the limited genetic available data and the complexity of their evolutionary relationships. Previous studies have primarily relied on morphological data that have not fully resolved the phylogenetic relationships within this subfamily. To address these gaps and provide a comprehensive approach, we conducted an extensive phylogenetic analysis incorporating a broad range of taxa and utilized both nuclear and mitochondrial markers. The results provide a better framework for resolving the phylogenetic relationships among these poorly studied taxa. Furthermore, by comparing our molecular phylogeny with the latest morphological classification of Microgastrinae, we aim to provide new insights and potential revisions to the current understanding of their evolutionary history. Our study represents a novel effort to integrate molecular and morphological data to enhance the phylogenetic resolution of Microgastrinae.

MATERIAL AND METHODS

Sampling and morphological studies. Specimens were collected using Malaise traps from March to November in 2020 and 2021 in the north-central Iran (i.e., Alborz, Guilan, Mazandaran, Qazvin and Tehran provinces). The north-central region of Iran includes both the northern and southern slopes of Alborz Mountains. The northern slope, recognized as the southern part of the Caucasus biodiversity hotspot (Noroozi et al., 2019), comprises Guilan and Mazandaran provinces, where 16 Malaise traps were placed. In contrast, the southern slope, as a part of the Irano-Anatolian biodiversity hotspot (Noroozi et al., 2019), includes Alborz, Tehran and Qazvin provinces, where 15 Malaise traps were placed. Malaise traps were set up in a range of different habitats such as forests, rangelands and orchards to ensure the actual reflection of the biodiversity in these environments. The collected parasitoids were preserved in 70% ethanol, and subsequent identification was conducted at the genus or species level using appropriate identification keys (Telenga, 1955; Nixon, 1965; Mason, 1981; Tobias, 1986). Each specimen was examined under the Olympus™ SZX9 stereomicroscope. The results of the identification of Microgastrinae in the North-central Iran, based on the morphological characters, have been published in recent years (Abdoli et al., 2019a, 2019b, 2019c; 2021a, 2021b; 2022). The examined material is deposited in the Insect Collection of the Department of Entomology, Tarbiat Modares University, Tehran, Iran (TMUC).

Extraction and sequencing. Total genomic DNA was extracted from the legs of the individuals using the Qiagen Dneasy Blood & Tissue Kit (Qiagen, Valencia, CA, USA). The quality of the extracted DNA was determined on a 1% agarose gel and the amount of total genomic DNA was quantified using Nanodrop (Allsheng, Nano -200, China). Two molecular markers were used to reconstruct the phylogeny tree including mitochondrial Cytochrome c oxidase subunit I, COI (5′ GGTCAACAAAT CATAAAGATATTGG 3′), HCO2198 (5′ TAAACTTCAGGGTGACCA AAAAATCA 3′) (Folmer et al. 1994) and 28S nuclear ribosomal DNA, 28S rDNA (5′ AAGAGAGAGTTCAAGAGTACGTG 3′), 28S_R (5′ TAGTTCACCATCTTTCGGGTCCC 3′) (Mardulyn & Whitfield, 1999). The PCR was performed in a 25 μL solution containing 12.5 μL Master Mix, 1 μL of each primer (10 pmol μL-1), 1 μL of extracted DNA and 9.5 μL double-distilled water. The PCR was carried out in the following steps: initial denaturation at 95°C for 3 min, followed by 5 cycles of 1 minute at 94ºC, 1 minute at 45ºC, 1 minute at 72ºC, and then 35 cycles of 1 minute at 94ºC, 1 minute at 51ºC, 1 minute at 72ºC, with a final extension step at 72ºC for 5 minutes. All PCR products were directly sequenced with both primers by Bio-Magic-Gene company in Iran. The COI and 28S rDNA sequences of the specimens were deposited in GenBank and other sequences used in comprehensive phylogenetic analyses were downloaded from NCBI and BOLD System (Table 1, and Table 2).

Phylogenetic analyses. Sequence alignment was performed using MAFFT online for COI and Muscle for 28S rDNA with MEGA7 (Tamura et al., 2013). The curation of alignments was performed manually using the MEGA7 method (Castresana, 2000). Sequences of both COI and the 28S rDNA were trimmed to 660 bp. The best-fit nucleotide substitution model was determined using MrModeltest 2 (Nylander, 2004). We employed BEAST v2.7.3 using an uncorrelated lognormal relaxed clock model (Drummond et al., 2012) and the constant rate birth-death process for the prior distribution on node heights (Gernhard, 2008), with default priors. A random coalescent starting tree, using default values for demographic parameters, was used for analyses in which BEAST was allowed to infer the root position. Convergence of likelihoods and model parameters was determined using Tracer. Most runs were terminated once these measures had been stable for at least 10 million generations, with preceding generations discarded as burn-in. Maximum clade credibility trees with mean node depths were calculated in Tree Annotator v2.7.3 (Drummond & Rambaut, 2007). The trees were rooted with Miracinae as outgroup. We visualized the resulting topology using FigTree v1.4.3.

Table 1. Taxa used in the molecular analysis of COI, along with accession numbers and source or locality.

Table 2. Taxa used in the molecular analysis of 28S rDNA, along with accession numbers and source or locality.

Phylogenetic relationships. A phylogenetic reconstruction of the subfamily Microgastrinae using DNA sequences from Mitochondrial COI and 28S rDNA molecular markers was explored, combining both newly obtained data and information from previous studies through Bayesian methods. The best-fitting model of nucleotide substitution was determined GTR+G+I for COI and 28S rDNA sequences. Molecular data were collected from 115 specimens belonging to 55 genera for COI (18 specimens determined in this study and 97 specimens from previously published data) (Table 1) and 52 specimens from 30 genera for 28S rDNA (18 specimens identified in this study and 34 specimens from previously published data) (Table 2). The following taxa were sequenced to reconstruct phylogenetic relationships of Microgastrinae: mitochondrial COI gene of ten species, Choeras formosus Abdoli & Fernandez-Triana, 2019, Choeras taftanensis Ghafouri Moghaddam & van Achterberg, 2018, Choeras tiro (Reinhard, 1880), Iconella radiata Abdoli & Talebi, 2020, Microplitis alborziensis Abdoli & Talebi, 2021, Microplitis kaszabi Papp, 1980, Dolichogenidea Fernandeztrianai Abdoli & Talebi, 2019, Diolcogaster mayae (Shestakov, 1932), Venanides caspicus Abdoli, Fernandez-Triana & Talebi, 2019, Pholetesor pseudocircumscriptus Abdoli, 2019, two genera (Venanides, Iconella); the 28S rDNA gene of nine species, Diolcogaster mayae (Shestakov, 1932), Choeras taftanensis Ghafouri Moghaddam & van Achterberg, 2018, Choeras qazviniensis Fernandez-Triana & Talebi, 2019, Choeras fulviventris Fernandez-Triana & Abdoli, 2019, Venanides caspicus Abdoli, Fernandez-Triana & Talebi, 2019, Pholetesor psudocircumscriptus Abdoli, 2019, Microplitis alborziensis Abdoli & Talebi, 2021, Microplitis kaszabi Papp, 1980, Iconella radiata Abdoli & Talebi, 2020 (Table 1, and Table 2).

RESULTS

Taxonomic hierarchy

Order Hymenoptera Linnaeus, 1758

Family Braconidae Nees von Esenbeck, 1811

Subfamily Microgasterinae Foerster, 1863

Phylogenetic analysis. The constructed phylogenetic trees of Microgastrinae based on the COI and 28S rDNA genes are shown in Figure 1, and Figure 2, respectively. In the COI gene tree, some taxa were recovered as well-supported sister, comprising Hypomicrogaster, Apanteles, Illidops; Iconella, Neoclarkinella; Dolichogenidea, Exoriza, Parapanteles; Alphomelon, Janhalacaste, Pseudapanteles, but in a well-supported clade with Rhygoplitis, Hygroplitis, Microgaster, Papanteles, Sendaphne, Dasylagon, Promicrogaster, Paroplitis, Shireplitis, Clarkinella, Glyptapanteles, Cotesia, Protapanteles, Sathon, Lathrapanteles. Other clades that were recovered together as paraphyletic included Diolcogaster, Buluka, Protomicroplitis, Larrismus, Parenion, Xanthomicrogaster; Jimwhitfieldius, Kotenkosius, Venanus, Mariapanteles, Miropotes, Venanides; Alloplitis, Philoplitis, Prasmodon, Zachterbergius, Rasivalva, Wilkinsonellus, and Microplitis, Snellenius, Choeras, Deuterixyes, Beyarslania. In the 28S rDNA gene tree, the genera which were recovered as well-supported sister taxa included Apanteles, Illidops, Alphomelon, Pholetesor, Rhygoplitis, Iconella, Exoryza, Dolichogenidea, Parapanteles; Pseudapanteles, Prasmodon; Glyptapanteles, Cotesia, Protapanteles; Venanides, Miropotes; Deuteryxis, Xanthomicrogaster; Microplitis, Snellenius, and Sendaphne, Dasylagon, Promicrogaster.

Synonymy. The available data in NCBI (National Center for Biotechnology Information: show that P. circumscriptus (Fig. 3A) and the recently described species, P. pseudocircumscriptus (Fig. 3B), for which DNA barcodes are available, differ by only 0.78% in their nucleotide sequences (a difference of 5 base pairs, resulting 99.22% identity). This minimal genetic divergence, combined with their morphological similarities, indicated that these two taxa are the same species, despite previous differentiation based on certain morphological features ((Abdoli & Pourhaji, 2019). Therefore P. psedocircumscriptus is proposed as a new synonym of P. circumscriptus (Table 3). Notably, it is mentioned that Pholetesor circumscriptus exhibits some variation in colouration, particularly in the legs and metasomal segments, depending on the region, especially in the Old World (Whitfield, 2006).

Figure 1. Bayesian tree to reconstruct phylogenetic relationships within Microgastrinae based on COI. Bayesian posterior probabilities greater than 0.70 are shown at the nodes.

Figure 2. Bayesian tree to reconstruct phylogenetic relationships within Microgastrinae based on 28S rDNA. Bayesian posterior probabilities greater than 0.70 are shown at the nodes.

Figure 3. Habitus, lateral view of Pholetesor species (females). A. Pholetesor circumscriptus (Nees, 1834) (Bold Systems); B. Pholetesor pseudocircumscriptus Abdoli, 2019 syn. nov.

Table 3. DNA barcodes of mitochondrial cytochrome c oxidase I (COI) of two Pholetesor species (Hymenoptera: Braconidae).

DISCUSSION

The comparison of our phylogenetic results shows notable congruence with the topologies presented by Whitfield et al. (2002), Mardulyn & Whitfield (1999) and Banks & Whitfield (2006). studies established that Apanteles s.str., Alphomelon and Rhygoplitis form a distinct clade (Banks & Whitfield, 2006; Mardulyn & Whitfield, 1999; Whitfield et al., 2002, 2018). Our 28S rDNA gene tree supports these taxonomic assignments, placing them within a newly identified and broader clade previously consisting of Apanteles, Illidops, Alphomelon, Pholetesor, Rhygoplitis. However, the COI gene tree suggests these genera as separate entities. The relationship between Promicrogaster and Sendaphne, highlighted by Whitfield et al. (2002), is confirmed in our analyses, revealing a new and broader clade in the COI gene tree, including Microgaster, Papanteles, Sendaphne, Dasylagon, Promicrogaster, Shireplitis, Clarkinella, Hypomicrogaster. In the 28S rDNA gene tree Sendaphne, Dasylagon, Promicrogaster form a distinct clade. Similarly, the close association of Prasmodon, Pseudapanteles into a distinct clade, as observed in prior studies (Banks & Whitfield, 2006; Mardulyn & Whitfield, 1999; Whitfield et al., 2002, 2018), is confirmed by our 28S rDNA gene tree, although COI gene tree fails to recover this phylogenetic relationship. The COI gene tree introduces a novel clade comprising Glyptapanteles, Cotesia, Protapanteles, Sathon, Lathrapanteles. The 28S rDNA gene tree also recovers Glyptapanteles, Cotesia, Protapanteles as sister taxa. Previous molecular analyses suggested a distinct clade including Glyptapanteles, Cotesia and Sathon (Whitfield et al., 2002; Mardulyn & Whitfield, 1999), but didn’t include Protapanteles and Lathrapanteles. Banks & Whitfield (2006) identified a clade with Glyptapanteles, Cotesia and Venanides, whereas our study incorporates Protapanteles, Sathon and Lathrapanteles. In both the 28S rDNA and COI gene trees, Microplitis is consistently recovered as sister to Snellenius, aligning with previous studies (Whitfield et al., 2002, 2018; Mardulyn & Whitfield, 1999; Banks & Whitfield, 2006).

The findings of this study reveal a close relationship between the current molecular analysis and the morphological classification by Fernandez-Triana et al. (2020). These results validate several of their morphological classifications and clarify the positions of certain previously unplaced genera (Four genera include Clarkinella, Neoclarkinella, Miropotes and Xanthomicrogaster) that were unresolved in the morphological study. For instance, in the COI gene tree, the positions of the genera within the Apanteles group as defined by Fernandez-Triana et al. (2020) are as follows: Apanteles, Illidops; Iconella, Neoclarkinella, Hygroplitis; Dolichogenidea, Exoriza, Parapanteles; Alphomelon, Janhalacaste, Pseudapanteles; Hypomicrogaster, Microgaster, Papanteles, Sendaphne, Dasylagon, Promicrogaster, Shireplitis, Clarkinella. In the 28S rDNA gene tree, the positions are Apanteles, Illidops, Alphomelon, Pholetesor, Rhygoplitis; Iconella, Exoryza, Dolichogenidea, Parapanteles, Sendaphne, Dasylagon, Promicrogaster. These results indicate a close relationship among the genera within the Apanteles group as defined by Fernandez-Triana et al. (2020). Although the analysis did not support the formation of a comprehensive clade, it demonstrates that the members of this group are not associated with genera outside the Apanteles group. Additionally, the findings suggest that the genera Clarkinella and Neoclarkinella, previously unplaced according to Fernandez-Triana et al. (2020) are closely related to the members of this group and likely belong to the Apanteles group.

The results from the COI gene tree analysis also reveal specific relationships among the members of Cotesia group as defined by Fernandez-Triana et al. (2020). The clades are as follows: Glyptapanteles, Cotesia, Protapanteles, Sathon, Lathrapanteles; Diolcogaster, Buluka, Protomicroplitis, Larrismus, Parenion, Xanthomicrogaster; and Miropotes, Venanides. Similarly, the 28S rDNA gene tree supports the associations of Glyptapanteles, Cotesia, Protapanteles; Deuteryxis, Xanthomicrogaster; and Venanides, Miropotes. The analysis demonstrates that Miropotes and Xanthomicrogaster, previously classified as unplaced by Fernandez-Triana et al. (2020), likely belong to the Cotesia group based on current genetic evidence, and consequently, they should be considered members of this group. The results of the Bayesian analyses of COI also exposed discrepancies with the classifications proposed by Fernandez-Triana et al. (2020), indicating the need for further investigation. In the present study, the taxa Microplitis, Snellenius, Alloplitis, Philoplitis, which were previously grouped together under the Microplitis group by Fernandez-Triana et al. (2020), were found to be separated. Specifically, Microplitis and Snellenius were placed apart from the other two genera. Current Bayesian analyses revealed some strongly supported clades, introducing novel phylogenetic hypotheses within Microgastrinae. In the COI phylogenetic tree, we identified two new clades, Alloplitis, Philoplitis, Prasmodon, Zachterbergius, Rasivalva, Wilkinsonellus and Microplitis, Snellenius, Choeras, Deuterixyes, Beyarslania. These clades are particularly noteworthy because they group together genera that were previously placed in distinct categories according to the classifications by Fernandez-Triana et al. (2020). This finding suggests a potential need for revising the current taxonomic framework, as the molecular data offer a more detailed understanding of the evolutionary relationships within Microgastrinae.

However, while the branching patterns in our COI and 28S rDNA phylogenetic trees exhibit some similarities, there are notable differences, particularly in the support for certain clades. The COI analyses tend to reveal more strongly supported clades compared to the 28S rDNA analyses, likely due to a more extensive database. The differences in results highlight the impact of missing data and how genera or groups evolved from the ancestors. The COI gene is more divergent compared to 28S rDNA and provides higher resolution at the species and genus levels compared to less variable genes like 28S rDNA (Machida & Tsuda, 2010; Blanco-Bercial et al., 2011; Patwardhan et al., 2014). Therefore, we used the 28S rDNA phylogenetic tree as a complementary source of information to the COI tree. In the COI phylogenetic tree, a clade labelled as the 'unknown group' was identified, comprising genera from the Microplitis group, Cotesia group, and several genera from the unplaced group. This newly recognized clade, supported by a high posterior probability, highlights the close evolutionary relationships among these taxa.

Molecular phylogenetic studies of Microgastrinae have historically been limited, often involving only a small number of samples, which can compromise the accuracy of phylogenetic inferences. Our study provides new insights into the evolutionary relationships within this subfamily by identifying well-supported clades at shallower taxonomic levels. The inclusion of a larger number of taxa in our analysis has led to a clearer understanding of phylogenetic relationships among the genera of Microgastrinae. However, due to incomplete data from taxa, further fieldwork efforts and the integration of additional molecular markers are necessary to enhance the robustness of our taxonomic conclusions. This study also proposed that P. psedocircumscriptus should be considered a new synonym of P. circumscriptus (Table 3). Notably, it is mentioned that Pholetesor circumscriptus exhibits some variation in colouration, particularly in the legs and metasomal segments, depending on the region, especially in the Old World (Whitfield, 2006). Based on the original description, P. circumscriptus is characterized by the following set of characters: vein R1 is long, longer than pterostigma and not less than 3.00–4.00 × longer than the distance from to the apex of the wing; ovipositor valve much less expanded apically; tergite 1 length 1.50× basal width, distinctly narrowed posteriorly, posterior width not more than one-third of basal width, and smooth posteriorly; posterior width of tergite 2, 1.50× (less than 2.00×) its medial length; anterior margin of postscutellum between the forwards-pointing projection and mid-point of postscutellum concave and phragma of scutellum strongly revealed, tergites 1–3 black or blackish, less frequently orange or yellow; body length about 1.80–2.00 mm (Nees, 1834). In P. psudocircumscriptus Tergite 1 shallowly rugulose posteriorly, the length of tergite I 1.80× basal width; posterior width of tergite II, 2.00× its medial length; Tergites II-II and basal half of Tergite III yellow; body length 1.40–1.50 mm (Abdoli & Pourhaji, 2019). Previous comprehensive studies on other species of Microgastrinae such as Microplitis ceratomiae Riley, 1881 (Ghafouri Moghaddam et al., 2021) and Microplitis manilae Ashmead, 1904 (Ghafouri Moghaddam & Butcher, 2023) revealed that the specimens show intraspecific variations in size and/or colour. Ecological factors play an important role in morphological differences which are common among populations of the same species (Pan et al., 2018). Furthermore, in braconid parasitoids with a wide host range, such as Habrobracon hebetor (Say, 1836), different hosts with varying sizes affect the size of wasp adults (Abou El-Ela et al., 2021).

Molecular methods are crucial for accurately identifying closely related species and distinguishing morphologically similar but genetically distinct species (Sharanowski et al., 2011). These techniques offer a level of precision that is often unattainable through traditional morphological approaches, effectively resolving taxonomic ambiguities and enhancing our understanding of species diversity (Belshaw & Quicke, 2002; Whitfield, 2002).

AUTHOR′S CONTRIBUTION

The authors confirm their contribution to the paper as follows: P. Abdoli: performed lab work, data curation, computational analyses, compiling the literature, drafting the manuscript; A.A. Talebi: conceived and designed the study, conceptualization, supervising, organizing the collection, editing and proofreading; N.G. Kavallieratos: conceived and designed the study, revised and edited previous and final version of this manuscript; R. Khosravi: computational analyses, revised and edited previous and final version of this manuscript; F. Bidari: performed lab work, data curation and computational analyses. All authors read and approved the final version of the manuscript.

FUNDING

This work has been supported by the center for International Scientific Studies & Collaboration (CISSC), Ministry of Science Research and Technology, Islamic Republic of Iran (Project No: 991215).

AVAILABILITY OF DATA AND MATERIAL

The COI and 28S rDNA sequence data of the specimens that support the findings of this study were deposited in the NCBI (GenBank accession numbers in Tables 1 and 2).

ETHICS APPROVAL AND CONSENT TO PARTICIPATE

This study only included arthropod material, and all required ethical guidelines for the treatment and use of animals were strictly adhered to in accordance with international, national, and institutional regulations. No human participants were involved in any studies conducted by the authors for this article.

CONSENT FOR PUBLICATION

Not applicable.

CONFLICT OF INTERESTS

The authors declare that there is no conflict of interest regarding the publication of this paper.

ACKNOWLEDGMENTS

Thanks to Insect Collection of the Department of Entomology, Tarbiat Modares University, Tehran, Iran (TMUC) for providing facilities. Special thanks to Dr Majid Pedram, Dr Mohammad Mehrabadi and Mr Ehsan Baradaran for their guidance on this study. We cordially thank the editor and two anonymous reviewers for their critical reviews and constructive comments which significantly improved the paper.

REFERENCES

Abdoli, P. & Pourhaji, A. (2019) Description of a new species of the genus Pholetesor Mason, 1981 and host association from Iran (Braconidae Microgastrinae). Redia, 102, 55–60.

       https://doi.org/10.19263/REDIA-102.19.08

Abdoli, P., Talebi, A.A. & Farahani, S. (2019a) Dolichogenidea fernandeztrianai sp. nov. (Hymenoptera: Braconidae, Microgastrinae) from Iran. Journal of Agricultural Science and Technology, 21 (3), 647–658.

Abdoli, P., Talebi, A.A., Farahani, S. & Fernandez-Triana, J. (2019b) Venanides caspius sp. nov. from Iran, the first species of Venanides (Hymenoptera: Braconidae) described from the Palaearctic Region. Acta Entomologica Mucei Nationalis Pragae, 59 (2), 543–548. https://doi.org/10.2478/aemnp-2019-0046

Abdoli, P., Talebi, A.A., Farahani, S. & Fernandez-Triana, J. (2019c) Three new species of the genus Choeras Mason, 1981 (Hymenoptera: Braconidae, Microgastrinae) from Iran. Zootaxa, 4545 (1), 77–92.

https://doi.org/10.11646/zootaxa.4545.1.4

Abdoli, P., Talebi, A.A., Fernandez-Triana, J. & Farahani, S. (2021a) Description of a new species of the genus Protapanteles Ashmead, 1898 (Hymenoptera: Braconidae: Microgastrinae) from Iran. Annales Zoologici, 71 (2), 289–295

Abdoli, P., Talebi, A.A., Fernandez-Triana, J. & Farahani, S. (2021b) Taxonomic study of the genus Microplitis Forster, 1862 (Hymenoptera, Braconidae, Microgastrinae) from Iran. European Journal of Taxonomy, 744, 83–118. https://doi.org/10.5852/ejt.2021.744.1305

Abdoli, P., Talebi, A.A. & Farahani, S. (2022) Additional review of the genus Iconella (Hymenoptera: Braconidae, Microgastrinae) from Iran with the description of a new species. North-Western Journal of Zoology, 18 (1), 9–16.

Abou El-Ela, A.S., Dessoky, E.S., Masry, S., Arshad, A., Munawar, A., Qamer, S., Abdelkhalek, A., Behiry, S.I., Kordy, A. (2021) Plasticity in life features, parasitism and super-parasitism behavior of Bracon hebetor, an important natural enemy of Galleria mellonella and other lepidopteran host species. Saudi Journal of Biological Science, 28 (6), 3351–3361. https://doi.org/10.1016/j.sjbs.2021.02.082

Banks, J.C. & Whitfield, J.B. (2006) Dissecting the ancient rapid radiation of microgastrine wasp genera using additional nuclear genes. Molecular Phylogenetics and Evolution, 41 (3), 690–703.

https://doi.org/10.1016/j.ympev.2006.06.001

Belshaw, R. & Quicke, D.L.J. (2002) Robustness of ancestral state estimates: Evolution of life history strategy in ichneumonoid parasitoids. Systematic Biology, 51 (3), 450–477.

Belshaw, R., Fitton, M., Herniou, E., Gimeno, C. & Quicke, D.L.J. (1998) A phylogenetic reconstruction of the Ichneumonoidea (Hymenoptera) based on the D2 variable region of 28S ribosomal RNA. Systematic Entomology, 23 (2), 109–23. https://doi.org/10.1046/j.1365-3113.1998.00046.x

Blanco-Bercial, L., Bradford-Grieve, J. & Bucklin, A. (2011) Molecular phylogeny of the Calanoida (Crustacea: Copepoda), Molecular Phylogenetics and Evolution, 59, 103–113. https://doi.org/10.1016/j.ympev.2011.01.008

Castresana, J. (2000) Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis. Molecular Biology and Evolution, 17, 540–552. https://doi.org/10.1093/oxfordjournals.molbev.a026334

Dong, Z., Qu, S., Landrein, S., Yu, W.B., Xin, J., Zhao, W. & Xin, P. (2022) Increasing taxa sampling provides new insights on the phylogenetic relationship between Eriobotrya and Rhaphiolepis. Frontiers in Genetics, 13, 831206. https://doi.org/10.3389/fgene.2022.831206

Dowton, M. & Austin, A.D. (1998) Phylogenetic relationships among the microgastroid wasps (Hymenoptera: Braconidae): combined analysis of 16S and 28S rDNA genes and morphological data. Molecular Phylogenetics and Evolution, 10 (3), 354–366. https://doi.org/10.1006/mpev.1998.0533

Dowton, M. & Austin, A.D. (2001) Simultaneous analysis of 16S, 28S, COI and morphology in the Hymenoptera: Apocrita evolutionary transitions among parasitic wasps. Biological Journal of the Linnean Society, 74 (1), 87–111. https://doi.org/10.1111/j.1095-8312.2001.tb01379.x

Drummond, A.J. & Rambaut, A. (2007) BEAST: Bayesian evolutionary analysis by sampling trees. BMC Evolutionary Biology, 7 (1), 1–8. https://doi.org/10.1186/1471-2148-7-214

Drummond, A.J., Suchard, M.A., Xie, D. & Rambaut, A. (2012) Bayesian phylogenetics with BEAUti and the BEAST 1.7. Molecular Biology and Evolution, 29 (8), 1969–1973. https://doi.org/10.1093/molbev/mss075

Fernandez‐Flores, S., Fernandez‐Triana, J.L., Martinez, J.J. & Zaldívar‐Riverón, A. (2013) DNA barcoding species inventory of Microgastrinae wasps (Hymenoptera, Braconidae) from a Mexican tropical dry forest. Molecular Ecology Resources, 13 (6), 1146–1150. https://doi.org/10.1111/1755-0998.12102

Fernandez-Triana, J.L. & Boudreault, C. (2018) Seventeen new genera of microgastrine parasitoid wasps (Hymenoptera, Braconidae) from tropical areas of the world. Journal of Hymenoptera Research, 64, 25–140. https://doi.org/10.3897/jhr.64.25453

Fernandez-Triana, J.L., Smith, M.A., Boudreault, C., Goulet, H., Hebert, P.D., Smith, A.C. & Roughley, R. (2011a) A poorly known high-latitude parasitoid wasp community: unexpected diversity and dramatic changes through time. PloS one, 6 (8), e23719. https://doi.org/10.1371/journal.pone.0023719

Fernandez-Triana, J.L., Ward, D.F. & Whitfield, J.B. (2011b) Kiwigaster gen. nov. (Hymenoptera: Braconidae) from New Zealand: the first Microgastrinae with sexual dimorphism in number of antennal segments. Zootaxa, 2932 (1), 24–32. https://doi.org/10.11646/zootaxa.2932.1.2

Fernandez-Triana, J.L., Cardinal, S., Whitfield, J.B., Hallwachs, W., Smith, M.A. & Janzenr, D.H. (2013) A review of the New World species of the parasitoid wasp Iconella (Hymenoptera, Braconidae, Microgastrinae). ZooKeys, 321, 65–87 https://doi.org/10.3897/zookeys.321.5160

Fernandez-Triana, J.L., Penev, L., Ratnasingham, S., Smith, M.A., Sones, J., Telfer, A., deWaard, J.R. & Hebert, P. D. (2014) Streamlining the use of BOLD specimen data to record species distributions: a case study with ten Nearctic species of Microgastrinae (Hymenoptera: Braconidae). Biodiversity Data Journal, (2), e4153.

https://doi.org/10.3897/BDJ.2.e4153

Fernandez-Triana, J.L., Whitfield, J.B., Smith, M.A., Dapkey, T., Hallwachs, W. & Janzen, D.H. (2016) Review of the world species of Exoryza (Hymenoptera, Braconidae, Microgastrinae), with description of five new species. Deutsche Entomologische Zeitschrift, 63, 195–210. https://doi.org/10.3897/dez.63.8977

Fernandez-Triana, J.L., Shaw, M.R., Boudreault, C., Beaudin, M. & Broad, G.R. (2020) Annotated and illustrated world checklist of Microgastrinae parasitoid wasps (Hymenoptera, Braconidae). ZooKeys, 920, 1–1089. https://doi.org/10.3897/zookeys.920.39128

Folmer, O., Black, M., Hoeh, W., Lutz, R. & Vrijenhoek, R. (1994) DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology, 3 (5), 294–299.

Ghafouri Moghaddam, M. & Butcher, B.A. (2023) Microplitis manilae Ashmead (Hymenoptera: Braconidae): biology, systematics, and response to climate change through ecological niche modelling. Insects, 14 (4), 338. https://doi.org/10.3390/insects14040338

Ghafouri Moghaddam, M., Tomlinson, S., Jaffe, S., Arias-Penna, D.C., Whitfield, J.B., Janzen, D.H., Hallwachs, W., & Latibari, M.H. (2021) Review of the New World species of Microplitis Foerster (Hymenoptera, Braconidae, Microgastrinae) attacking Sphingidae (Lepidoptera, Bombycoidea). Insect Systematics & Evolution, 53 (3), 221–241. https://doi.org/10.1163/1876312X-bja10026

Gernhard, T. (2008) The conditioned reconstructed process. Journal of Theoretical Biology, 253 (4), 769–778.

https://doi.org/10.1016/j.jtbi.2008.04.005

Hebert, P.D., Ratnasingham, S., Zakharov, E.V., Telfer, A.C., Levesque-Beaudin, V., Milton, M.A., Pedersen, S., Jannetta, P. & DeWaard, J.R. (2016) Counting animal species with DNA barcodes: Canadian insects. Philosophical Transactions of the Royal Society B: Biological Sciences, 371 (1702), 20150333.

https://doi.org/10.1098/rstb.2015.0333

Jantzen, J.R., Whitten, W.M., Neubig, K.M., Majure, L.C., Soltis, D.E. & Soltis, P.S. (2019) Effects of taxon sampling and tree reconstruction methods on phylodiversity metrics. Ecology and Evolution, 9 (17), 9479–9499.

https://doi.org/10.1002/ece3.5425

Jasso-Martínez, J.M., Quicke, D.L.J., Belokobylskij, S.A., Santos, B.F., Fernández-Triana, J.L., Kula, R.R. & Zaldívar-Riverón, A. (2022) Mitochondrial phylogenomics and mitogenome organization in the parasitoid wasp family Braconidae (Hymenoptera: Ichneumonoidea). BMC Ecology and Evolution 22, 46.

https://doi.org/10.1186/s12862-022-01983-1

Machida, R.J. & Tsuda, A. (2010) Dissimilarity of species and forms of planktonic Neocalanus copepods using mitochondrial COI, 12S, Nuclear ITS, and 28S Gene Sequences, PloS One, 5. e10278.

https://doi.org/10.1371/journal.pone.0010278

Mardulyn, P. & Whitfield, J.B. (1999) Phylogenetic signal in the COI, 16S, and 28S genes for inferring relationships among genera of Microgastrinae (Hymenoptera; Braconidae): evidence of a high diversification rate in this group of parasitoids. Molecular Phylogenetics and Evolution, 12 (3), 282–294.

https://doi.org/10.1006/mpev.1999.0618

Mason, W.R.M. (1981) The polyphyletic nature of Apanteles Förster (Hymenoptera: Braconidae): phylogeny and reclassification of Microgastrinae. Memoirs of the Entomological Society of Canada, 115, 1–147.

       https://doi.org/10.4039/entm113115fv

Murphy, N., Banks, J.C., Whitfield, J.B. & Austin, A.D. (2008) Phylogeny of the parasitic microgastroid subfamilies (Hymenoptera: Braconidae) based on sequence data from seven genes, with an improved time estimate of the origin of the lineage. Molecular Phylogenetics and Evolution, 47 (1), 378–395.

https://doi.org/10.1016/j.ympev.2008.01.022

Nabhan, A.R. & Sarkar, I.N. (2012) The impact of taxon sampling on phylogenetic inference: a review of two decades of controversy. Briefings in Bioinformatics, 13 (1), 122–134. https://doi.org/10.1093/bib/bbr014

Nixon, G.E.J. (1965) A reclassification of the tribe Microgasterini (Hymenoptera: Braconidae). Bulletin of the British Museum (Natural History) Entomology, 2, 1–284.

Noroozi, J., Talebi, A., Doostmohammadi, M., Manafzadeh, S., Asgarpour, Z. & Schneeweiss, G.M. (2019) Endemic diversity and distribution of the Iranian vascular flora across phytogeographical regions, biodiversity hotspots and areas of endemism. Scientific Reports, 9 (1), 12991. https://doi.org/10.1038/s41598-019-49417-1

Nylander, J.A.A. (2004) MrAIC. pl. Program distributed by the author. Evolutionary Biology Centre, Uppsala University. Available from https://github.com/nylander/pMrAIC [Accessed March 12, 2024]

Pan, Z-X, Hong, F. & Jiang, G-F. (2018) Morphometrics reveal correlation between morphology and bioclimatic factors and population mixture in Tetrix japonica (Orthoptera: Tetrigidae). Acta Zoolgica, 99, 199–210.

https://doi.org/10.1111/azo.12240

Parks, K., Janzen, D.H., Hallwachs, W., Fernandez-Triana, J.L., Dyer, L.A., Rodriguez, J.J., Arias-Penna, D.C. & Whitfield, J.B. (2020) A five-gene molecular phylogeny reveals Parapanteles Ashmead (Hymenoptera: Braconidae) to be polyphyletic as currently composed. Molecular Phylogenetics and Evolution, 150, 106859. https://doi.org/10.1016/j.ympev.2020.106859

Patwardhan, A., Ray, S. & Roy, A. (2014) Molecular markers in phylogenetic studies-a review. Journal of Phylogenetics & Evolutionary Biology, 2 (2), 131. https://doi.org/10.4172/2329-9002.1000131

Pitz, K., Dowling, A.P.G., Sharanowski, B.J., Boring, C.A.B., Seltmann, K.C. & Sharkey, M.J. (2007) Phylogenetic relationships among the Braconidae (Hymenoptera: Ichneumonoidea) as proposed by Shi et al.: a reassessment. Molecular Phylogenetics and Evolution, 43, 338–343. https://doi.org/10.1016/j.ympev.2006.11.010

Rannala, B., Huelsenbeck, J.P., Yang, Z. & Nielsen, R. (1998) Taxon sampling and the accuracy of large phylogenies. Systematic Biology, 47 (4), 702–710. https://doi.org/10.1080/106351598260680

Rodriguez, J.J., Fernandez-Triana, J.L., Smith, M.A., Janzen, D.H., Hallwachs, W., Erwin, T.L. & Whitfield, J.B. (2013) Extrapolations from field studies and known faunas converge on dramatically increased estimates of global microgastrine parasitoid wasp species richness (Hymenoptera: Braconidae). Insect Conservation and Diversity, 6 (4), 530–536. https://doi.org/10.1111/icad.12003

Sharanowski, B.J., Dowling, A.P. & Sharkey, M.J. (2011) Molecular phylogenetics of Braconidae (Hymenoptera: Ichneumonoidea), based on multiple nuclear genes, and implications for classification. Systematic Entomology, 36 (3), 549–572. https://doi.org/10.1111/j.1365-3113.2011.00580.x

Shaw, M.R. & Huddleston, T. (1991) Classification and Biology of Braconid Wasps. Royal Entomological Society, 126 p.

Shi, M. & Chen, X.X. (2005) Molecular differentiation of the microgastrine species commonly found in paddy fields from Southeast Asia, with additional data on their phylogeny (Hymenoptera: Braconidae). Insect Science, 12 (3), 155–162. https://doi.org/10.1111/j.1005-295X.2005.00019.x

Smith, M.A., Fernandez-Triana, J., Roughley, R. & Hebert, P. (2009) DNA barcode accumulation curves for understudied taxa and areas. Molecular Ecology Resources, 9, 208–216.

https://doi.org/10.1111/j.1755-0998.2009.02646.x

Smith, M.A., Fernandez-Triana, J.L., Eveleigh, E., Gómez, J., Guclu, C., Hallwachs, W., Hebert, P.D.N., Hrcek, J., Huber, J.T., Janzen, D., Mason, P.G., Miller, S., Quicke, D.L.J., Rodriguez, J.J., Rougerie, R., Shaw, M.R., Várkonyi, G., Ward, D.F., Whitfield, J.B. & Zaldívar‐Riverón, A. (2013) DNA barcoding and the taxonomy of Microgastrinae wasps (Hymenoptera, Braconidae): impacts after 8 years and nearly 20000 sequences. Molecular Ecology Resources, 13 (2), 168–176. https://doi.org/10.1111/1755-0998.12038

Tamura, K., Stecher, G., Peterson, D., Filipski, A. & Kumar, S. (2013) MEGA6: molecular evolutionary genetics analysis version 6.0. Molecular Biology and Evolution, 30 (12), 2725–2729.

https://doi.org/10.1093/molbev/mst197

Telenga, N.A. (1955) Hymenoptera Vol 5. No 4. Family Braconidae: subfamily Microgasterinae, subfamily Agathidinae. Fauna SSSR (ns), USSR Academy of Sciences, Russia. 312 p.

Tobias, V. I. (1986) Subfamily Microgasterinae. In: Medvedev, G.S. (ed.) Keys to the Insects of the European Part of the USSR. Amerind Publishing Co. Pvt. Ltd, Leningrad, pp. 605–816.

Whitfield, J.B. (2002) Estimating the age and historical biogeography of the microgastrine wasp genus Cotesia (Hymenoptera: Braconidae) using Bayesian methods. Molecular Phylogenetics and Evolution, 22 (3), 384–398.

Whitfield, J.B. (2006) Revision of the Nearctic species of the genus Pholetesor Mason (Hymenoptera: Braconidae). Zootaxa, 1144 (1), 1–94.

Whitfield, J.B., Mardulyn, P., Austin, A.D. & Dowton, M. (2002) Phylogenetic relationships among microgastrine braconid wasp genera based on data from the 16S, COI and 28S genes and morphology. Systematic Entomology, 27 (3), 337–359. https://doi.org/10.1046/j.1365-3113.2002.00183

Whitfield, J.B., Austin, A.D. & Fernandez-Triana, J.L. (2018) Systematics, biology, and evolution of microgastrine parasitoid wasps. Annual Review of Entomology, 63, 389–406. https://doi.org/10.1146/annurev-ento-020117-043405